circad | circRNAs associated with diseases

circRNA_659
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	26472973
Experimental Method
Sample Type	Mammary gland Tissues	Comparison	Liquid Nitrogen frozen mammary glands harvested from five rats on day 1 and 7 postpartum
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TATGTTGATCGGCGTGACTACC Reverse CCACCACTGTCTTCCACTCATT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, C, Wu, H, Wang, Y, Zhao, Y, Fang, X, Chen, C, Chen, H (2015). Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats. J Breast Cancer, 18, 3:235-41.